7 apply a striping theme to an unordered list

Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx

Ngày tải lên : 21/12/2013, 19:15

... serial or COM1 It may or may not be identified Step Locate the RJ-45 to DB-9 adapter One side of the adapter connects to the PCs serial interface and the other to the RJ-45 rollover cable connector ... connectors a Examine the router or switch and locate the RJ-45 connector labeled “Console” Step Identify the computer serial interface, which is COM or a It should be a or 25-pin male connector labeled ... serial interface on the PC or dumb terminal is a DB-25, an RJ-45 to DB-25 adapter will be needed Both of these adapters typically come with a Cisco router or switch Step Locate or build a rollover...

6
476
0

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Ngày tải lên : 11/08/2014, 08:21

... National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National Institutes of Health Grant AI054558 to J.L., F.R.F and R.M.R Author details ... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... JBW and SYL performed statistical analysis JBW drafted the manuscript RR and JL revised the manuscript All authors read and approved the final manuscript Competing interests The authors declare...

7
393
0

Hướng dẫn bói bài Tarot Real tarot a modern approach to an ancient art

Ngày tải lên : 17/02/2016, 11:57

... great success as an outcome, and by drawing an action card as well, you can discover the best way to proceed towards that goal 16 Chapter - A Journey through the Major Arcana The Major Arcana are ... will agree that this card can be seen as a warning to look carefully at your financial situation, and to be cautious in all matters relating to money Two of Wands Wands are the suit of energy and ... sculptor stands upon a pew, with a mallet and chisel in his hands A priest and an architect with blueprints in his hands stand near this craftsman, discussing the changes they need to make to the...

92
354
1

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

Ngày tải lên : 07/09/2013, 13:19

... examine the nature and function of language in detail All of these, according to Ferguson (1972), agree on two points: language is an answer to a need to communication, and language forms are ... until the major part of the grammatical system has been learned The structural syllabus is very familiar to language teachers, and it has several advantages However, structural syllabus has its shortcomings ... in a given speech act Bygate (1987) considers speaking as an undervalued skill in many ways The reason is that almost speakers can speak, and so take speaking skill too much for granted He also...

43
591
1

Giáo án dạy ngày 2 buổi( Tuần 7 lớp A)

Ngày tải lên : 27/09/2013, 00:10

... Gi a tra n¾ng chang chang mµ ch¸u kh«ng ®éi mò th× sÏ bÞ c¶m ®Êy V× ch¸u ®i mãt l a gi a tra nh thÕ nµy? Em ®¸p: - Ch¸u tiÕc nh÷ng b«ng l a r¬i nªn tranh thđ bi tra ®i mãt l a cho ngan ¨n.Bi tra ... tØnh – thµnh : S¬n La, Lai Ch©u, §iƯn Biªn, Hµ Giang, Thanh Ho¸, NghƯ An, Qu¶ng Nam, Gia Lai, Kon Tum, B×nh D¬ng, §ång Th¸p,… Tªn c¸c danh lam th¾ng c¶nh : VÞnh H¹ Long, hå Ba BĨ, hå Hoµn KiÕm, ... víi mong íc c a anh chiÕn sÜ n¨m xa? H: Em m¬ íc ®Êt níc ta mai sau ph¸t triĨn nh thÕ nµo? GV chèt: *M¬ íc níc ta cã mét nỊn c«ng nghiƯp ph¸t triĨn ngang tÇm thÕ giíi *M¬ íc níc ta kh«ng cßn nghÌo...

34
534
0

Giáo án dạy ngày 2 buổi( Tuần 7 lớp A và B)

Ngày tải lên : 27/09/2013, 00:10

... tả trang phục số dân tộc Tây Nguyên :Trang phục truyền thống :nam thờng đóng khố ,nữ thờng quấn váy -HSKG :Quan sát tranh ảnh,mô tả nhà rông Tây Nguyên II) Đồ dùng: - Phiếu học tập - Tranh, ảnh ... tả trang phục số dân tộc Tây Nguyên :Trang phục truyền thống :nam thờng đóng khố ,nữ thờng quấn váy -HSKG :Quan sát tranh ảnh,mô tả nhà rông Tây Nguyên II) Đồ dùng: - Phiếu học tập - Tranh, ảnh ... việt 4) ngời Việt Nam - TL nhóm 4, báo cáo BT3: Viết hoa tên: a Bốn vị anh hùng dân tộc lịch sử n- - NX, s a sai ớc ta mà em biết b Bốn ca sĩ, nhạc sĩ,diễn viên điện ảnh (Việt Nam ) mà yêu thích...

19
490
0

Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Ngày tải lên : 24/10/2013, 08:20

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... of Idea Group Inc is prohibited Managing and Practicing OD in an IT Environment 261 how to proceed with the validated data, and the action plan and goals they create can be compared against...

33
567
0

Tài liệu Converting a DataSet to an ADO Recordset docx

Ngày tải lên : 14/12/2013, 18:16

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...

15
390
0

Tài liệu Cấp giấy phép thầu cho nhà thầu nước ngoài là tổ chức nhận thầu các gói thầu thuộc dự án nhóm A và các dự án đầu tư thuộc địa bàn 2 tỉnh trở lên doc

Ngày tải lên : 24/01/2014, 19:20

... công trình xây dựng Tài liệu đính kèm viết Mau don xin phep thau T1TW.doc(Mau don xin phep thau T1TW_1249971538514.doc) Tải Mau bao cao T1TW.doc(Mau bao cao T1TW_1249971538274.doc) Tải ... kiện 3: Trong trường hợp giao thầu (do thắng thầu thông qua đấu thầu chọn thầu) nhà thầu nước phải liên danh với nhà thầu Việt Nam phải sử dụng nhà thầu phụ Việt Nam (trừ trường hợp Thủ tướng ... phép theo quy định pháp luật Việt Nam) d) Yêu cầu điều kiện 4: Phải cam kết thực đầy đủ quy định pháp luật Việt Nam có liên quan đến hoạt động nhận thầu Việt Nam 1.11 Căn pháp lý thủ tục hành...

3
341
0

Tài liệu Exporting the Results of a Query to an Array pdf

Ngày tải lên : 26/01/2014, 10:20

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

5
309
0

A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living ppt

Ngày tải lên : 05/03/2014, 13:20

... options to avoid pregnancy Once a woman is pregnant, her body will go through many changes Pregnant women also have many options to deliver and to take care of their babies Pregnancy If a woman has ... contain cancer, and they not spread (Benign means “not dangerous.”) Malignant tumors are cancer They can kill you It is very important to treat malignant tumors as soon as possible (Malignant means ... Health A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living Naomi Soto, Maria Koonce, Gregory Smith Florida Literacy Coalition Florida’s Adult and...

37
546
0

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Ngày tải lên : 07/03/2014, 10:20

... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... trypsinogens are predictors of distant metastasis and survival in early-stage non-small cell lung cancer Cancer Res 64, 55645569 21 Marsit CJ, Karagas MR, Danaee H, Liu M, Andrew A, Schned A, Nelson...

11
469
0

Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot

Ngày tải lên : 07/03/2014, 12:20

... Moffat, National Research Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a ... of action of linear amphipathic alpha helical antimicrobial peptides Biopolymers 47, 451463 48 Tytler EM, Segrest JP, Epand RM, Nie SQ, Epand RF, Mishra VK, Venkatachalapathi YV & Anantharamaiah ... Instruments, Madison, WI, USA), and, for each sample, absorbance spectra were produced For these spectra, water bands were subtracted, and the evaluation of peptide band parameters (peak position, band...

12
688
0

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efﬁcient ILP Solution to Chinese Word Segmentation" ppt

Ngày tải lên : 07/03/2014, 18:20

... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw...

9
425
0

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Ngày tải lên : 18/03/2014, 01:20

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

8
1.1K
0

Breast cancer incidence and case fatality among 4.7 million women in relation to social and ethnic background: a population-based cohort study pdf

Ngày tải lên : 29/03/2014, 01:20

... the data and the accuracy of the data analysis OB and TM conceived and designed the study TM acquired the data Analysis and interpretation of data were undertaken by OB, PH, AE and TM OB drafted ... circumstances and advanced carcinoma Int J Cancer 2004, 108:754-760 Lagerlund M, Maxwell AE, Bastani R, Thurfjell E, Ekbom A, Lambe M: Sociodemographic predictors of non-attendance at invitational mammography ... immigrants’ daughters, particularly among those whose parents were from low-risk areas, such as Asia and Latin America This is in agreement with studies on immigrants from Asia and Latin America...

13
408
0

A Primer on Developing An E-Business Strategy - Submitted to: First Stop Business Information Center docx

Ngày tải lên : 29/03/2014, 19:20

... loans, auto loans, credit card loans, Small Business Administration guaranteed loans, commercial mortgage loans, and certain other loans As part of the program, Treasury provided through TARP authorities ... for TARP equity, loan, and guarantee transactions were made using available data and methods to capture additional potential costs related to uncertainty around the expected cash flows to and ... Bureau’s approach to nonbank examination will be the same as its approach for banks In October 2011 and January 2012, respectively, the Bureau released a general CFPB Examination Manual to guide...

76
356
0

Báo cáo khoa học: "A Generic Approach to Parallel Chart Parsing with an Application to LinGO" pdf

Ngày tải lên : 31/03/2014, 04:20

... Engineering, 6(1):1–18 [Manousopoulou et al.1997] A. G Manousopoulou, G Manis, P Tsanakas, and G Papakonstantinou 1997 Automatic generation of portable parallel natural language parsers In Proceedings ... Kentaro Torisawa, and Jun’ichi Tsujii 2001 An agentbased parallel HPSG parser for shared-memory parallel machines Journal of Natural Language Processing, 8(1), January [Nurkkala and Kumar1994] Tom ... like charts and a thread-safe uniﬁcation algorithm CaLi is an instance of a MACAMBA application that implements a Chart parser for the LinGO grammar The design of CaLi was based on PET (Callmeier,...

8
333
0

Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust

Ngày tải lên : 05/05/2014, 08:45

... Several authors have found that plants can be induced to be resistant against infectious agents when properly stimulated (Kuc 1985, DEAN and Kuc 1985, ScHOENBECK et al 1980), and that plants may ... cotton and sprayed on the abaxial (under) leaf surface with 152 DAGMAR S ROVERATTl, ANA REGINA R TEIXEIRA and WALKYRIA B C MORAES the inducer preparation, using nitrogen as the propellent gas, ... leaf (Table 3) The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial surface (Table...

12
421
0

A Systems Approach to Conduct an Effective Literature Review in Support of Information Systems Research

Ngày tải lên : 02/06/2014, 09:38

... understanding of the concepts presented by Han and Kamber Han and Kamber (2001) suggest an evolution that moves from data collection and database creation, towards data management, and ultimately, ... evolution that moves from data collection and database creation, towards data management, and ultimately, data analysis and understanding Figure 7: Pre-comprehension level mastery Although the citation ... ultimately, data analysis and understanding For example, data processing is a base function enabling manipulation and aggregation of data, thus facilitating searching and retrieval Figure 8:...

32
467
0